We read every piece of feedback, and take your input very seriously.
To see all available qualifiers, see our documentation.
Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.
By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.
Already on GitHub? Sign in to your account
Add an assembly from this gff where the mRNA has no exons or CDSs children:
##gff-version 3 ctgA example gene 100 200 . + . ID=MyGene ctgA example mRNA 100 200 . + . ID=MyGene.1;Parent=MyGene ##FASTA >ctgA cattgttgcggagttgaacaACGGCATTAGGAACACTTCCGTCTCtcacttttatacgat tatgattggttctttagccttggtttagattggtagtagtagcggcgctaatgctacctg aattgagaactcgagcgggggctaggcaaattctgattcagcctgacttctcttggaacc ctgcccataaatcaaagggttagtgcggccaaaacgttggacaacggtattagaagacca acctgaccaccaaaccgtcaattaaccggtatcttctcggaaacggcggttctctcctag atagcgatctgtggtctcaccatgcaatttaaacaggtgagtaaagattgctacaaatac gagactagctgtcaccagatgctgttcatctgttggctccttggtcgctccgttgtaccc
When the mouse hovers on the gene (which may not be visible), we get this error in Firefox:
In Chrome the error is:
The text was updated successfully, but these errors were encountered:
No branches or pull requests
Add an assembly from this gff where the mRNA has no exons or CDSs children:
When the mouse hovers on the gene (which may not be visible), we get this error in Firefox:
In Chrome the error is:
The text was updated successfully, but these errors were encountered: